ID: 1030414539_1030414540

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1030414539 1030414540
Species Human (GRCh38) Human (GRCh38)
Location 7:109225735-109225757 7:109225771-109225793
Sequence CCATGGATGTAAGAGTTTATATC CTGTTCCATTGTATTATGTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!