ID: 1030465923_1030465925

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1030465923 1030465925
Species Human (GRCh38) Human (GRCh38)
Location 7:109903725-109903747 7:109903750-109903772
Sequence CCTGTAGTTTTCTTTTCTTGATG TACTTACTTGGTTTTGTATCAGG
Strand - +
Off-target summary {0: 9, 1: 128, 2: 381, 3: 1321, 4: 3312} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!