ID: 1030542185_1030542195

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1030542185 1030542195
Species Human (GRCh38) Human (GRCh38)
Location 7:110844785-110844807 7:110844830-110844852
Sequence CCAACTCCACATTTCCATCTCTG CCAGGAAATTTACTGGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 80, 4: 1119} {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!