ID: 1030563358_1030563365

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1030563358 1030563365
Species Human (GRCh38) Human (GRCh38)
Location 7:111119813-111119835 7:111119862-111119884
Sequence CCTGGTGAAGGAAAGGATCAAGG AGCCATGGGACCACTGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 199} {0: 1, 1: 0, 2: 1, 3: 6, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!