ID: 1030616620_1030616623

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1030616620 1030616623
Species Human (GRCh38) Human (GRCh38)
Location 7:111744143-111744165 7:111744163-111744185
Sequence CCTCAGTATGGGATGTGCACCAC CACTGAGAAGGTAGCAACCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!