ID: 1030616620_1030616625

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1030616620 1030616625
Species Human (GRCh38) Human (GRCh38)
Location 7:111744143-111744165 7:111744172-111744194
Sequence CCTCAGTATGGGATGTGCACCAC GGTAGCAACCTTGGGCCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 932} {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!