ID: 1030616622_1030616632

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1030616622 1030616632
Species Human (GRCh38) Human (GRCh38)
Location 7:111744162-111744184 7:111744214-111744236
Sequence CCACTGAGAAGGTAGCAACCTTG TCCCTGAAGGGCCTGACAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 31, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!