ID: 1030661476_1030661482

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1030661476 1030661482
Species Human (GRCh38) Human (GRCh38)
Location 7:112223671-112223693 7:112223703-112223725
Sequence CCCACAAAGGCGCTTTTGTCCAG CAAAATTTTTTGAGAGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 87} {0: 1, 1: 0, 2: 4, 3: 46, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!