ID: 1030717771_1030717774

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1030717771 1030717774
Species Human (GRCh38) Human (GRCh38)
Location 7:112830533-112830555 7:112830550-112830572
Sequence CCTGAAGAACATCTCTCATGTAT ATGTATATCTTGAGGAAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!