ID: 1030748158_1030748164

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1030748158 1030748164
Species Human (GRCh38) Human (GRCh38)
Location 7:113194303-113194325 7:113194335-113194357
Sequence CCCAGGCCAATGTCCTGAAGATT GTGTTCTTGTAGTAGTTTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 22, 2: 60, 3: 135, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!