ID: 1030771428_1030771430

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1030771428 1030771430
Species Human (GRCh38) Human (GRCh38)
Location 7:113479987-113480009 7:113480012-113480034
Sequence CCTGAGCAACATAGCAAAATCCT CTGTACACACAGAAAAAGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!