ID: 1030774625_1030774628

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1030774625 1030774628
Species Human (GRCh38) Human (GRCh38)
Location 7:113518618-113518640 7:113518647-113518669
Sequence CCTTTAAAACCATTTAAAACTGT AAAAGCATAAAGTTTCTGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 58, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!