ID: 1030803849_1030803855

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1030803849 1030803855
Species Human (GRCh38) Human (GRCh38)
Location 7:113889021-113889043 7:113889053-113889075
Sequence CCTACCTCTATAAAATCTAAATT CTGTATATGGAGGTGAAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 824} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!