ID: 1030855817_1030855824

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1030855817 1030855824
Species Human (GRCh38) Human (GRCh38)
Location 7:114555934-114555956 7:114555972-114555994
Sequence CCTTGTCTTCTATACCTCCCTCA AACCACTGCTGACATGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 369} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!