ID: 1030884916_1030884920

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1030884916 1030884920
Species Human (GRCh38) Human (GRCh38)
Location 7:114924563-114924585 7:114924610-114924632
Sequence CCGAAAATCTAGAGTGGCCTGAA GTTATCAGTGTAGAAACTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!