ID: 1030963183_1030963191

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1030963183 1030963191
Species Human (GRCh38) Human (GRCh38)
Location 7:115952986-115953008 7:115953021-115953043
Sequence CCACCTCCCTGGGTCCATCCTCC ATGACACCGATGTGCTCACTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 97, 4: 945} {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!