ID: 1031025197_1031025211

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1031025197 1031025211
Species Human (GRCh38) Human (GRCh38)
Location 7:116672252-116672274 7:116672295-116672317
Sequence CCGGCCCCAACGCGCCCGGGCCG TGCCCGGCTGAGTCACTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 276} {0: 1, 1: 0, 2: 1, 3: 22, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!