ID: 1031026521_1031026525

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1031026521 1031026525
Species Human (GRCh38) Human (GRCh38)
Location 7:116685765-116685787 7:116685810-116685832
Sequence CCAACCAGAGTCTGCATGTCGGT GTTAAAAAAGTCAAAATCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80} {0: 1, 1: 0, 2: 2, 3: 36, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!