ID: 1031048225_1031048227

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1031048225 1031048227
Species Human (GRCh38) Human (GRCh38)
Location 7:116918235-116918257 7:116918257-116918279
Sequence CCAGTTCTTTTTAATGGGGTCAA ATAATGGACATTCTAGTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164} {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!