ID: 1031057284_1031057287

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1031057284 1031057287
Species Human (GRCh38) Human (GRCh38)
Location 7:117006325-117006347 7:117006368-117006390
Sequence CCAGTCAGTAGCAGTGTAGCATG TGTACCCTTTCTTAGACTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!