ID: 1031059535_1031059539

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1031059535 1031059539
Species Human (GRCh38) Human (GRCh38)
Location 7:117034968-117034990 7:117035005-117035027
Sequence CCGGAAACAGCATTGCTACCCTC AGAATGAAAAACTTTTACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 114} {0: 1, 1: 0, 2: 2, 3: 39, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!