ID: 1031069261_1031069264

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1031069261 1031069264
Species Human (GRCh38) Human (GRCh38)
Location 7:117143699-117143721 7:117143720-117143742
Sequence CCAGGGTGCTAGTTTAGTACTCA CACCTCACAGGGTAGATGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 42, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!