ID: 1031085490_1031085498

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1031085490 1031085498
Species Human (GRCh38) Human (GRCh38)
Location 7:117298110-117298132 7:117298158-117298180
Sequence CCCCACTGGCTATCAGTATAACA GTGGCCAGTTAGAAGAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!