ID: 1031125846_1031125849

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1031125846 1031125849
Species Human (GRCh38) Human (GRCh38)
Location 7:117772537-117772559 7:117772559-117772581
Sequence CCCTATAACTGTTTAAACTGGAA ACACATTAGAGAGTAAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185} {0: 1, 1: 2, 2: 11, 3: 40, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!