ID: 1031154445_1031154450

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1031154445 1031154450
Species Human (GRCh38) Human (GRCh38)
Location 7:118093491-118093513 7:118093525-118093547
Sequence CCTGAGAATCTTTCCTCCCTTTC TAAAACCCCCAAATTTATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 282} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!