ID: 1031313212_1031313213

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1031313212 1031313213
Species Human (GRCh38) Human (GRCh38)
Location 7:120225700-120225722 7:120225719-120225741
Sequence CCTCAAATTCGCAGACAAAAAGA AAGACCAATAAATTCTCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 376} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!