ID: 1031323431_1031323436

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1031323431 1031323436
Species Human (GRCh38) Human (GRCh38)
Location 7:120362851-120362873 7:120362871-120362893
Sequence CCACCTCTATAGGTTGGATGCAG CAGGGTGAACAGAACCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 83} {0: 1, 1: 0, 2: 5, 3: 72, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!