ID: 1031325719_1031325728 |
View in Genome Browser |
Spacer: 28 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1031325719 | 1031325728 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:120394682-120394704 | 7:120394733-120394755 |
| Sequence | CCATGGTTAGCTAGCCCTACACC | CTGTGAGACTAGAAGTAAGATGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 15, 3: 25, 4: 153} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||