ID: 1031393785_1031393792

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1031393785 1031393792
Species Human (GRCh38) Human (GRCh38)
Location 7:121247838-121247860 7:121247866-121247888
Sequence CCCTCCAAGAAGTTTTATCCCCA CTGCTTAGCCAGAAGAAAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!