ID: 1031406732_1031406748

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1031406732 1031406748
Species Human (GRCh38) Human (GRCh38)
Location 7:121395965-121395987 7:121396011-121396033
Sequence CCGGGACCCCAGTCCCGCCTGCG CGTGACAACGCGGCCGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 266} {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!