ID: 1031427315_1031427319

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1031427315 1031427319
Species Human (GRCh38) Human (GRCh38)
Location 7:121621387-121621409 7:121621400-121621422
Sequence CCTGAGCTGCACCCTTAAACCAT CTTAAACCATCTGTGCTTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!