ID: 1031485604_1031485606

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1031485604 1031485606
Species Human (GRCh38) Human (GRCh38)
Location 7:122319687-122319709 7:122319712-122319734
Sequence CCTGGCACATAAATTATAATTTG AGGTACACACCATTTTAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 437} {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!