ID: 1031492902_1031492905 |
View in Genome Browser |
Spacer: 4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1031492902 | 1031492905 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:122411119-122411141 | 7:122411146-122411168 |
| Sequence | CCATCTACCATCAGCAGATCAGA | TGTTAGTATCTTTTGATTTATGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 158} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||