ID: 1031493657_1031493663

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1031493657 1031493663
Species Human (GRCh38) Human (GRCh38)
Location 7:122420881-122420903 7:122420894-122420916
Sequence CCATACATTTAAGAAGAGATCCT AAGAGATCCTACTGGGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192} {0: 1, 1: 0, 2: 2, 3: 18, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!