ID: 1031497329_1031497334

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1031497329 1031497334
Species Human (GRCh38) Human (GRCh38)
Location 7:122466404-122466426 7:122466417-122466439
Sequence CCCCTCTGGGGCCACAGTGTTTT ACAGTGTTTTCCAGCAACATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!