ID: 1031529317_1031529325

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1031529317 1031529325
Species Human (GRCh38) Human (GRCh38)
Location 7:122856994-122857016 7:122857016-122857038
Sequence CCAGCCCTCCTCTCCCCATAAGG GTTTTTGCAGATATTCATCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 444} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!