ID: 1031597232_1031597236

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1031597232 1031597236
Species Human (GRCh38) Human (GRCh38)
Location 7:123662362-123662384 7:123662414-123662436
Sequence CCATTGCAGAGATGCTCAAAGTC GTCCAACTTCATAACGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 207} {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!