|
Left Crispr |
Right Crispr |
| Crispr ID |
1031613118 |
1031613125 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:123850351-123850373
|
7:123850380-123850402
|
| Sequence |
CCCACTTCAGCCTCCTGAGTATC |
CACAGGAACGCACCACCAGCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 24, 1: 1759, 2: 21663, 3: 122966, 4: 216472} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|