ID: 1031613119_1031613125

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1031613119 1031613125
Species Human (GRCh38) Human (GRCh38)
Location 7:123850352-123850374 7:123850380-123850402
Sequence CCACTTCAGCCTCCTGAGTATCT CACAGGAACGCACCACCAGCCGG
Strand - +
Off-target summary {0: 23, 1: 1738, 2: 17174, 3: 31543, 4: 43272} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!