ID: 1031613123_1031613125 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1031613123 | 1031613125 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:123850364-123850386 | 7:123850380-123850402 |
| Sequence | CCTGAGTATCTGGAACCACAGGA | CACAGGAACGCACCACCAGCCGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 20, 2: 971, 3: 17614, 4: 145307} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||