ID: 1031645438_1031645449

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1031645438 1031645449
Species Human (GRCh38) Human (GRCh38)
Location 7:124220439-124220461 7:124220486-124220508
Sequence CCACCCAAATCTCATCTTGAATT CATGAGAGGGACCCAGTGGAAGG
Strand - +
Off-target summary No data {0: 5, 1: 81, 2: 740, 3: 1483, 4: 3100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!