ID: 1031645619_1031645626

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1031645619 1031645626
Species Human (GRCh38) Human (GRCh38)
Location 7:124221847-124221869 7:124221878-124221900
Sequence CCTGAAGAAGCTACAGACACTCA CCGTGAAAGCCCCTGGGATGGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 141, 3: 1665, 4: 2273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!