|
Left Crispr |
Right Crispr |
| Crispr ID |
1031695310 |
1031695321 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:124844448-124844470
|
7:124844500-124844522
|
| Sequence |
CCATTGGCACCGGGCGCGGTGGC |
GCCGAGGCGGGTAGATCACGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 13, 3: 101, 4: 496} |
{0: 170, 1: 10506, 2: 47437, 3: 70293, 4: 63646} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|