ID: 1031713186_1031713192

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1031713186 1031713192
Species Human (GRCh38) Human (GRCh38)
Location 7:125075113-125075135 7:125075139-125075161
Sequence CCAAATCTCATGTCAAATTATAA CCAGTGTTGAAAAGGGGGCCTGG
Strand - +
Off-target summary {0: 70, 1: 970, 2: 2325, 3: 4808, 4: 9310} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!