ID: 1031753663_1031753666

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1031753663 1031753666
Species Human (GRCh38) Human (GRCh38)
Location 7:125611424-125611446 7:125611471-125611493
Sequence CCACATAGTAGAGAGTGAGATTC GTGATTATGGGACTTTGCATTGG
Strand - +
Off-target summary No data {0: 6, 1: 75, 2: 158, 3: 169, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!