ID: 1031788441_1031788450

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1031788441 1031788450
Species Human (GRCh38) Human (GRCh38)
Location 7:126065960-126065982 7:126065975-126065997
Sequence CCTCCCACGGGGTCCCTCCCATG CTCCCATGACAGATGGGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 18, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!