ID: 1031827855_1031827864

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1031827855 1031827864
Species Human (GRCh38) Human (GRCh38)
Location 7:126588780-126588802 7:126588830-126588852
Sequence CCAGGAGACAGCCCAAATACTAT GGGTGAACACACACCCTCACTGG
Strand - +
Off-target summary {0: 1, 1: 18, 2: 124, 3: 183, 4: 222} {0: 1, 1: 0, 2: 4, 3: 40, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!