ID: 1031827856_1031827864

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1031827856 1031827864
Species Human (GRCh38) Human (GRCh38)
Location 7:126588791-126588813 7:126588830-126588852
Sequence CCCAAATACTATGAGTGCCCAAA GGGTGAACACACACCCTCACTGG
Strand - +
Off-target summary {0: 5, 1: 83, 2: 225, 3: 189, 4: 240} {0: 1, 1: 0, 2: 4, 3: 40, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!