ID: 1031832672_1031832675

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1031832672 1031832675
Species Human (GRCh38) Human (GRCh38)
Location 7:126646481-126646503 7:126646495-126646517
Sequence CCTCCCTCTCTCAGCATTGAAAC CATTGAAACTTCCATTTCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 42, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!