ID: 1031837127_1031837132

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1031837127 1031837132
Species Human (GRCh38) Human (GRCh38)
Location 7:126691410-126691432 7:126691440-126691462
Sequence CCAAAAGTGCAGAGATGCCTGAG CCGCAGCTAGGTCGCTGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 56, 3: 153, 4: 640} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!